Wolfram Ostertag - Böcker
Visar alla böcker från författaren Wolfram Ostertag. Handla med fri frakt och snabb leverans.
4 produkter
4 produkter
1 632 kr
Skickas inom 10-15 vardagar
The meeting was devoted to “hot topics” in Stem cell research such as Regulation of Haematopoietic and Non-haematopoietic Stem Cells, Clinical Application of Stem Cells, Preclinical Models and Gene Therapy.
1 632 kr
Skickas inom 10-15 vardagar
This publication was initiated on the occasion of the NATO-Advanced Study Institute (ASI) meeting “Stem Cells and their potential for clinical application” which took place from August 23 – 25, 2006 in Kyiv and from August 26 – 31, 2006 in Simeiz, Ukraine. The meeting was devoted to “hot topics” in Stem cell research such as Regulation of Haematopoietic and Non-haematopoietic Stem Cells, Clinical Application of Stem Cells, Preclinical Models and Gene Therapy. The editors are pleased that the original idea of a book could eventually be realised. This was made possible because of the willingness of many meeting participants to saddle themselves with the additional work of compiling their data and thoughts in form of an article for this edition. We are thus foremost grateful to all contributors for their valuable input. In accordance with the conference’s main topics, the book is divided into five chapters - “Haematopoietic stem cells and haematopoiesis”, “Biology of n- haematopoietic stem cells”, “Stem cells and malignancy”, “Cell processing; expansion and genetic modification” and “Clinical haematopoietic stem cell transplantation”.
1 091 kr
Skickas inom 10-15 vardagar
The 11 th meeting in "Modern Trends in Human Leukemia" took place from June 19 to 21, 1994 in Wilsede in the middle of the Liineburger Heide, South of Hamburg. Interwoven with the Leukemia program was the Nato-sponsored Symposium of the ASI-Series "Gene Technology in Analysis of Malignant and Inherited Human Diseases Related to Development" . The Wilsede meeting was continued on a ship of the Neva leading through lake Ladoga and lake Onega. The topics of both meetings included discussion on recent progress isolation and development of hematopoietic stem cells, genes crucial for development and diseases, methods of gene transfer, application of gene transfer; oncogenes and anti-oncogenes as targets for gene therapy; receptors and their ligands in normal development and diseases, immunology and immunotherapy, radiation biology, clinical leukemias and bone marrow transplantation. The Nato workshop concentrated not only on analysis of cell systems useful for somatic gene therapy, but also on actual themes directly related to correction of human diseases. The latter aspects emphasized themes related to biotechnology, the first part was by nature more general. We also included a few contributions that discussed perspectives for the future of gene therapy and possible relationships to evolution.
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Häftad, Engelska, 2011
1 059 kr
Skickas inom 10-15 vardagar
Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa- tion for activation of lymphokine genes.To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 * -96 -84 GGAGATTCCCC IL-2R (p55) ...